genoma.unsam.edu.ar :: tupaia :: tu-c-t-01a13.b1

Sequence

>tu-c-t-01a13.b1
GAGGNNATACGATGGCCATTGGCCCGACGTCGCATGCTCCCTGGCGGCCTGGGGAATTCG
ATTAGCGTGGTCGCTGCCGAGGTACAGAAAGGCTGTCCTGGTGGTCCACCCAGATAAAGC
TACTGGGCAACCCTATGAACAATATGCAAAGATGATTTTCATGGAGCTAAATGATGCCTG
GTCTGAATTTGAAAACCAAGGCCAAAAGCCCTTGTATTAACCTATGAGCTCTCCCTTTCT
GCTGCAGACTGTGCTAATGCTTAGTGTGTGTCACGGTTCCAAGGTTTTCACAGATGAACC
AAAAATTCCAGTAACATGTTTTCAGTACCTGCCGGGGCGAGTCGCXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXGGTCCAATTCCGGCAACGTACGATCCCTGAGCAAAAAGTTT
ATCGCTTGAAAAAATTTTCCCCTTACCACAAAACATTTTTTTTTTCCCCCCTTCG


BLAST summary (best hit)

Human Genome, June 2002 Assembly  
Chromosome 1 (65829692 - 65829903)    
Score: 178  Identity: 94.1%  
This is the best hit out of 1 total hits.
sp  BLAST report  
sp|Q27974|AUXI_BOVIN Auxilin   Goto Swissprot  
Score: 98.6  Expect: 8e-21
nr  BLAST report  
gi|7662146|ref|NP_055602.1| (NM_014787) DnaJ (Hsp40) homolog, subfamily C, member 6; KIAA0473 gene product; DnaJ (Hsp40) homolog, subfamily B, member 6 [Homo sapiens] dbj|BAA32318.1| (AB007942) KIAA0473 protein [Homo sapiens]   Goto GenBank  
Score: 98.6  Expect: 6e-20
dbest  BLAST report  
gb|BQ717182.1|BQ717182 AGENCOURT_8232613 Lupski_sympathetic_trunk Homo sapiens cDNA clone IMAGE:6191507 5'.   Goto GenBank  
Score: 335  Expect: 9e-90
tupaia_mitochondria  BLAST report  
No hits